美羅華在淋巴瘤治療中的應(yīng)用.ppt

Lymphoma: A Decade of Rituximab and the Next Chapter,Wenru Song, MD, PhD Pfizer Global Research & Development-Oncology & Baylor Institute for Immunology Research,Outline,Historical perspective & reflections in Rituximabs development Impact of Rituximab -Lymphoma -Rheumatoid arthristis, lupus, and other autoimmune diseases -Other solid tumors New emerging therapies in lymphoma,Monoclonal Antibodies from Hybridoma Technology,Georges Kohler and Cesar Milstein (1975) in Nature. Monoclonal antibodies are artificially produced against a specific antigen. Production of monoclonal antibodies (mAbs) with hybridoma technique. With this technique a group of lymphocytes producing all the same antibody protein is obtained. revolutionizing diagnostic medicine. Mabs against cancer, infections, and other diseases.,History of Monoclonal Antibody (Mab) Therapy,Murine Mab *Ibritomomab *tositumomab,Humanized *trastuzumab *bevacizumab *TheraCIM,Chimeric *Cetuximab *rituximab *131I -Ch-TNT,Human *panitumumab,1975: First murine Mab from hybridoma (Kohler and Milstein, Nature) 1980s-90s: Humanization of murine Mabs (chimeric Mab) 2019: 1st Mab for cancer immunotherapy: Rituximab 2019: Fully human Mab: -XenoMouse (Abgenix), HuMab-mouse (Medarex) or Phage scFv library,2019- 2019: 11 Mabs approved for use in cancer by US FDA,FDA Approved Monoclonal Antibodies,The “Ups & Downs” of Monoclonal Antibody (mAb) Development,“Hey, these are magic bullets”,“mAbs should be even in soup”,“I heard there are some problems”,“Id apply them only to my enemies”,“mAbs work in some cases!”,1975,1982,1986,1994,2019,First mAb produced,Success in lymphoma,OKT3 approved,Lilly purchase Hybritech ($350m),Wellcome drops Campath,Panorex & ReoPro app.,Rituximab,Genetic engineering,Jesus Gomez-Navarro,5th most common cancer in both men and women in US Hodgkins lymphoma and Non-Hodgkins Lymphoma (NHL) Incidence increases 3-4% annually (doubled in last 2 decades), one of only two cancers with continued increase Many sub-types of NHL, majority with B-cell origin -Diffuse large B cell lymphoma (DLBCL): most common NHL (30%) -Follicular lymphoma (FL): 2nd most common NHL (20%) -Mantle cell lymphoma (MCL): poorest prognosis (6-10%) Leading the oncology field in disease biology, diagnosis, and therapy (radiation, chemo, immunotherapy, chemo-immunotherapy),Lymphoma,Rituximab (Rituxan, MabThera) Targeted therapy -CD20 on lymphoma -direct tumor killing by Rituximab Immunotherapy -host immune system -indirect tumor killing by host immune cells,Natural Killler Cells Monocytes,FcR,2) Complement-mediated Killing,1) Apoptosis, Anti-proliferation,3) Antibody-dependent Cellular Cytotoxicity (ADCC),Tumor Cell,FcR,Dendritic Cells,4) Antigen Presentation and Cross-priming,Rituximab Anti-tumor Effect: Proposed Mechanisms,CD20 or other tumor Ags,T Cells,Vaccine-like effect after Rituximab Treatment,* In vivo: longer duration of remission after re-treatment with Rituxan than the initial Rituxan treatment *In vitro: enhanced cross-priming of cytoxic T cells by Rituxan-induced apopotic tumor cells,FcR,Dendritic Cells,T Cells,Tumor,1st FDA-approved therapeutic antibody to treat cancer (11/2019) 1st fully integrated into chemo-immunotherapy (R-chemo) 1st and only biologic therapy in combination with chemo (R-CVP, etc) that improved progress-free survival (PFS) in pts with 1st line follicular lymphoma, with emerging trend to improve overall survival for the 1st time 1st treatment of any kind (with CHOP or anthracycline-based chemo) to have improved overall survival (OS) in 1st line DLBCL in more than 25 yrs,Rituximab (Rituxan, MabThera): A history of firsts,Chimeric mab to CD20, IgG1 Weekly x 4 (375mg/m2): Rapid CD20+B cell depletion in blood (100%-few days), BM (90%-1wk), and LN (80%- a few wks), return normal level in 9-12 months Onset and maximal clinical response: 1mt and 3-4 mts Initial Rx in relapsed FL: 50% ORR (6%CR; 44%PR); mDR 11mt; Re-Rx: ORR 40% (10%CR/30%PR); mDR 15mt Maintenance Rx: Qwk X4 every 6 mt or Q3mt for 2 yrs No change of serum Ig and incidence of infection, and the T cell response from vaccination is still OK,Rituximab (Rituxan, MabThera): Facts,Anti-idiotype (Id) antibody,Lymphoma B cell,Two lines of Monoclonal Antibody Therapy Development For Lymphoma,Rituximab,CD20,Tumor Idiotype (Id),New England Journal of Medicine, 306:517. 1982 Treatment of B Cell Lymphoma with Monoclonal Anti-Idiotype Antibody Richard A Miller, David G. Maloney, Roger Warnke, and Ronald Levy,Cancer Res. 1980;40:3147 Serotherapy of a patient with a monoclonal antibody (murine anti-human CD20 Mab) directed against a human lymphoma-associated antigen Lee Nadler, et al,Antibodies: a slow breakthrough of a new technology,Technologies to reduce immunogenicity of monoclonal antibodies: technological evolution towards humanization, human antibodies innovation biography of drugs,Christian Zeller,1976 1978, 1985, 1986 12/1992 03/1993 2019 03/96 11/97, 06/98 2019,IND from IDEC,1st pt In P1 Levy,last pt In P3,FDA,EMEA,1st line; R-chemo; maintenance,Timeline of Rituximab Development,IDEC & Genentech/Roche Co-develop,Hybritech,IDEC,Biotherapy System Levy/Miller,Genentech Boyer/Cohen,CD20 gene In 1980 Nadler,IDEC,Development of IDECs Stock Prices,Christian Zeller,Phase I trial done IDEC & Genentech Co-develop,FDA approval,Phase I: 1993-94 -single dose: 10, 50, 100, 250, 500 mg/m2, No MTD -15 pts: 2 PR (100, 500 mg/m2) -Maloney DG, Blood 84:2457, 1994 Phase I: 1994-95 -multiple dose (weekly x 4): 125, 250, 375 mg/m2, No MTD -20 pts: 6 PRs (1/3 in 125, 2/6 in 250, 3/9 in 375), ORR=33% -Maloney DG, J Clin Onc 15:3266, 2019 Phase II: 2019-96 -Fixed dose (375 mg/m2), weekly x4 (determined by the available Mab) -37 pts: 3 CR/14PR (ORR=46%), mTTP 10.2 months -Maloney DG, Blood 90:2188, 2019 Phase II/III Pivotal trial: 2019-96,Early clinical development of Rituximab,Rituximab Pivotal Phase II/IIITrial: Clinical Response in Relapsed Indolent or Follicular Lymphoma,McLaughlin et al. J Clin Oncol. 2019.,Outline,Historical perspective in Rituximabs development Impact of Rituximab -Lymphoma -Rheumatoid arthritis, lupus, and other autoimmune diseases -Other solid tumors New emerging therapies in lymphoma,Randomized Trials of Chemotherapy plus Rituximab versus Chemotherapy Alone in B-Cell Lymphoma,Cheson B, Leonard J. N Engl J Med 2019; 359:613,Randomized Trials of Maintenance Treatment with Rituximab versus Observation,Randomized Trials of Maintenance Treatment with Rituximab versus Observation,Cheson B, Leonard J. N Engl J Med 2019;359:613-626,Extended Uses of Rituximab: Integration into Lymphoma Standard of Care,Salvage therapy for chemo-refractory or relapsed: low grade Up-front therapy Delay or avoid chemotherapylow grade Combination therapy With chemotherapy With other biologicals- enhance ADCC With other monoclonals Maintenance therapy,Mortality Rates of Non-Hodgkins Lymphoma,Rituximab Publications,Number of publications,Year,Publications,1st clinical trial,160,180,200,80,100,120,140,0,20,40,60,Jan/91,92,93,94,95,96,97,98,99,00,FDA approval,Pivotal trial results,1 million pts worldwide being treated,4378 in 2019,Rituxan / MabThera: a blockbuster,Christian Zeller,Top 5 Best Selling Oncology Drugs in 2019,Pfizer-Oncology,Approved MAbs for Cancer Therapy,*First approved in China,Outline,Historical perspective in Rituximabs development Impact of Rituximab -Lymphoma -Rheumatoid arthristis, lupus, and other autoimmune diseases -Other solid tumors New emerging therapies in lymphoma (phase I-III trials) -human or humanized anti-CD20: enhanced ADCC, CDC -Other new targets: CD22, CD40, CD80, mTOR, HDAC, Revlimid, Avastin, Velcade, PKC-b, TRAIL, Bcl-2, CTLA-4 -Rituxan-based combinational Bio-Rx -In situ vaccines (dendritic cells, CpG),Cheson B, Leonard J. N Engl J Med 2019;359:613-626,Unconjugated Monoclonal Antibodies for B-Cell Cancers,Investigational Combination BioRx for B-Cell Cancers,Most potent “antigen-presenting cells” Reside in tissues to collect antigen - travel to lymph nodes Co-culture with antigens - cellular vaccine,Dendritic Cells,In situ Vaccination with DC,Chemo+DC 15/15,DC,Chemo +,Chemo 0/8,DC 0/7,No Rx 0/9,Mean Tumor Size,Days post tumor implantation,Song & Levy Can Res 2019,Dendritic Cells,Chemotherapy Or Radiotherapy,Leukapheresis,Intratumoral DC Vaccination + Conventional Therapy,Intratumor Injection,2,1,3,US FDA approvd three Investigational New Drug (INDs) Applications: -Colon cancer with hepatic metasteses (phase I; Stanford) -Locally advanced pancreatic cancer (phase I/II; Stanford) -Lymphoma and other solid tumors (phase I/II; Baylor),Intratumoral DC Vaccination + Conventional Therapy: From Lab to Clinic,CpG bridges innate and adaptive immunity,Bacterial DNA ACGTTGAGTTCGTACGCATACGA Vertebrate DNA AGCTTGAGTCmCGGATGGGTAAGA Immune system recognizes CpG through TLR-9 and induces activation of DC, B & T cells,Dendritic Cell,Tumor-specific T Cells,CpG,TLR-9,TLR-9,B Cell Tumor,CpG Only Works Intra-Tumorally,Li J, Song W, et al., J Immunol. 2019,179:2493,Radiation,In situ Vaccination with CpG,CpG,Pre-treatment,Week 12,63 yo male with recurrent follicular lymphoma: partial response,ASCO 2019,US Oncology Growth Market Projections,Acknowledgement,Stanford University Medical Center Ronald Levy Edgar Engleman Baylor Institute for Immunology Research & Baylor Sammons Cancer Center -Jacques Banchereau, Steve Paulson -Marylene Leogier, Jingtao Chen, Licun Wu, Zhiqing Wang $ Baylor University Healthcare System Foundation $ US National Cancer Institute/NIH Pfizer Oncology: Jesus Gomez-Navarro,Questions?,Function:,antibody,Two Arms of the Immune System,B cells (Humoral),T cells (Cellular),Make antibodies,Kill abnormal cells,foreign substance (antigen),Abnormal cell,Antibody Structure,The Immune System is a mixture of Clones,Each B cell can make only one antibody Each T cell can make only one T cell receptor,FcgR IIIA 158 V/F polymorphism V/V V/F F/F F Carriers 8/10 12/28 9/23 21/51 (80%) (43%) (39%) (41%) p=0.037 Weng and Levy J Clin Onc 2019,Rituximab Clinical Response Determined by Host Genetics,7